Выделение простейших: Биология — 10

Содержание

Биология — 10

Выделение листьями

  • Какую функцию выполняет каждый орган выделительной системы в отдельности?

Удаление конечных продуктов обмена веществ из организма называется выделением. Живые организмы имеют разные органы выделения.

Выделение у растений. У растений нет специальных органов выделения. Большинство растений удаляет газообразные продукты выделения через устьица. Вы знаете, что выделение паров воды через устьица называется транспирацией. У таких растений, как земляника и пшеница происходит гуттация — выделение капелек воды. Вместе с водой у этих растений удаляются соли и другие вещества. Нектар и эфирные масла, синтезируемые растениями, также являются продуктами выделения. Некоторые вредные вещества накапливаются у растений в клеточном соке вакуолей, а удаляются вместе с листьями во время листопада.

Часть растений избавляется от ненужных веществ через корни.

Выделение у простейших животных. Обитающие в пресных водах такие одноклеточные, как обыкновенная амеба, зеленая эвглена и инфузория-туфелька содержат в клетках сократительные вакуоли. Эти вакуоли собирают продукты выделения. Сократительные вакуоли периодически лопаются, и излишки воды с растворенными в ней вредными веществами удаляются наружу через мембрану клетки. Таким образом, выделение у простейших связано с регуляцией осмотического давления и диффузией.

Выделение у инфузории-туфельки

Многоклеточные беспозвоночные. Губки и кишечнополостные не имеют специальных органов выделения. Они удаляют продукты выделения через поверхность тела путем диффузии.

Инфекции, передаваемые половым путем Medical On Group Хабаровск

Инфекции , передаваемые половым путем (ИППП) — это группа заболеваний , которые передаются преимущественно во время полового контакта. ИППП чрезвычайно распространены во всем мире. Эксперты ВОЗ (Всемирной организации здравоохранения ) подсчитали: каждый шестой житель земного шара страдает какой-либо из болезней, передаваемых половым путем.

Все ИППП вызываются болезнетворными микроорганизмами ( бактериями, вирусами, простейшими, паразитами) и передаются преимущественно при половом контакте и через кровь (в основном через шприцы или инструменты). Но некоторые инфекции, например, сифилис, герпетическая, цитомегаловирусная  и папилломавирусные инфекции могут передаваться посредством контакта («кожа к коже») и через поцелуи.

Вирусные ИППП, такие как ВИЧ-инфекция, гепатит, генитальный герпес и аногенитальные бородавки, вызываемые вирусом папилломы человека, полностью не излечиваются, и лишь в части случаев течение заболевания и его проявления удается контролировать с помощью различных средств и методов. Излечиваемыми на сегодняшний день являются ИППП, вызываемые бактериями, простейшими и паразитами: сифилис, гонорея, хламидии, трихомониаз и некоторые другие. Однако, в любом случае раннее обращение к врачу и начало лечения не только послужит скорейшему выздоровлению, но и позволит снизить риск развития многочисленных осложнений. 

Для мужчин!
ИППП может заразиться абсолютно любой из мужчин, который занимается незащищенным и беспорядочным сексом. Заболеть очень просто, а лечиться — гораздо сложнее. Мужчины, помните, что причины заражения любой из инфекций, передаваемых половым путем, — халатное отношение к своему здоровью!

Коварство инфекций, которые передаются половым путем, заключается в том, что для заразившихся мужчин болезнь может протекать без ярко выраженных симптомов или совсем незаметно в течение определенного времени. Отсутствие мужского внимания на появление у себя некоторых признаков и симптомов начинающейся болезни, а также несвоевременное или неправильное лечение способствуют тому, что заболевание приобретает скрытый или хронический характер. Заболевание у мужчин со скрытым характером опасно тем, что болезнь достаточно быстро приобретает хроническую форму, которую значительно тяжелее лечить, а порой даже уже и невозможно. Хронический характер заболевания, вызванный ИППП, может способствовать тому, что у мужчин начинается воспаление мочеполовой системы, приводящее к ослаблению эрекции, преждевременной эякуляции, простатиту, аденоме, импотенции, бесплодию и другим серьезным заболеваниям мужской половой системы. Если в мужском организме болезнь приобрела хроническую форму, то проявляться симптомами ей уже необязательно, ведь симптомы — это показатель активной борьбы организма с проникновением инфекции.

Какие симптомы должны Вас насторожить ?!

  1. Необычные выделения белого или желтого цвета из полового члена, часто с неприятным запахом.

  2. Сильный зуд, жжение, болезненное мочеиспускание, частые позывы на мочеиспускание.

  3. Розовая или красная сыпь, покраснение, пятна на разных участках тела, например, на ногах (подошвы), на руках (ладони).

  4. Резкие или тянущие болевые ощущения в районе низа живота и яичек.

  5. Увеличение лимфатических узлов, особенно в паховой зоне.

  6. Мелкие пузырьки, эрозии, бородавки, язвы в районе рта, губ и ануса.

  7. Аномальное разрастание тканей в районе заднего прохода и непосредственно на половом члене.

При заражении ИППП у мужчин могут возникать и другие симптомы, которые встречаются гораздо реже, например, болезненные ощущения во время близости, нарушение семяизвержения или повышение температуры тела.

Чаще всего у мужчин  встречаются следующие  ИППП: хламидиоз, трихомониаз, микоплазмоз, уреаплазмоз, гарднереллез, гонорея и сифилис.

Для женщин!
Наиболее частные симптомы ИППП у женщин. Что должно насторожить ?

  1. Неприятный запах из влагалища.

  2. Увеличение количества выделений из половых путей, изменение их цвета и структуры.

  3. Появление болевых ощущений при мочеиспускании.

  4. Сильный зуд в области гениталий.

  5. Неприятные ощущения во время секса.

  6. Легкое недомогание, головная боль, вялость, сонливость.

  7. Задержка менструации или кровотечение в середине цикла. 

Проявления могут быть различными в зависимости от заболевания: 

  1. При генитальном герпесе на внешней поверхности половых органов возникают пузырьки, которые сильно чешутся, через несколько дней они лопаются и превращаются в язвочки. Заразиться таким герпесом легко, а вот вылечить эту болезнь сложно, можно лишь уменьшить количество рецидивов.

  2. Сифилис — это очень коварное заболевание, первые симптомы возникают спустя несколько недель. На половых органах появляется небольшая язва. Примерно через 2 недели она увеличивается в размерах, наблюдается уплотнение лимфоузлов. Проявления сифилиса одинаковы у мужчин и у женщин. Первичная язва (сифилитический шанкр) может возникать и не в области половых органов. В зависимости от способа заражения, шанкры могут появляться в любой точке кожного покрова или слизистой. Инфицирование сифилисом может происходить и неполовым путем (например, при переливании крови), в таких случаях первичный шанкр отсутствует и для обнаружения заболевания может потребоваться больше времени.

  3. При трихомониазе наблюдается изменение цвета влагалищных выделений. Они становятся желтыми или зеленоватыми, имеющими неприятный запах.

  4. Хламидиоз — это болезнь, которая может передаваться не только при половом контакте, но и бытовым путем. Первые признаки возникают через неделю. Характерны частые и болезненные мочеиспускания, маточные кровотечения, боли внизу живота и в области спины.

  5. Гонорея (триппер) может долгое время протекать без каких-либо симптомов. В большинстве случаев больные жалуются на желтые или зеленые гнойные выделения с неприятным запахом, резкие боли внизу живота. Частое и болезненное мочеиспускание как у мужчин, так и у женщин.

!!!!Самолечением в такой ситуации заниматься опасно. Из острой формы инфекция может перейти в хроническую, тогда первичные симптомы исчезнут, но опасность для здоровья увеличится. Возрастает и риск заражения полового партнера.

Важно помнить ,что многие ИППП протекают без всяких симптомов ! Если ваш партнер заражен ,то и вы можете быть заражены , даже если пока симптомы заболевания не дают о себе знать!

Помните, что ИППП  вызывают неприятные последствия как для женщин (бесплодие, эктопическую беременность,  осложнения родов и послеродового периода и др.), так и для  мужчин (простатит, и как следствие импотенция) .

Поэтому крайне важно не заниматься поиском лечебных методов в интернете, а обратиться за квалифицированной диагностикой и своевременным лечением к врачу! Именно врач подберет те диагностические и лечебные программы, которые помогут вовремя выявить заболевание и своевременно с ним справиться!

Анализ кала на яйцеглист – Сдать анализ на яйца гельминтов в лаборатории KDL

Исследования кала на простейших и яйца гельминтов – рутинный диагностический тест, много лет применяющийся в лабораторной диагностике. Гельминты широко распространены во всех климатических зонах, заражению больше всего подвержены дети, владельцы домашних животных и люди, работающие с животными или работающие на земле. Выявление яиц гельминтов проводится методом микроскопии препарата кала пациента. Так как у гельминтов есть определенные циклы размножения, то по объективным причинам не всегда можно выявить яйца паразитов в кале при наличии инвазии.

Нередко для подтверждения диагноза паразитарного заболевания может потребоваться несколько исследований кала на гельминтов.

В каких случаях обычно назначают исследование кала на яйца гельминтов?

Обычно анализы на яйца глист обязательно назначаются всем детям перед посещением школы, детского сада, бассейна, спортивных секций и т.д. Это обязательное исследование при диспансеризации здоровых школьников.

Целесообразно исследовать кал на простейших и гельминтов при наличии признаков возможного паразитарного заболевания. Жалобы на периодические боли в животе, неустойчивый стул, аллергические проявления, кожные высыпания, утомляемость могут быть симптомами глистной инвазии. Если в клиническом (общем) анализе крови есть снижение гемоглобина и повышенное число эозинофилов, то это тоже повод сдать анализ на яйца гельминтов.

Важно: при заражении острицами – энтеробиозе, исследование кала на яйца гельминтов может быть неинформативным, так как эти паразиты откладывают яйца на коже перианальной области и лучшим методом диагностики служит соскоб на энтеробиоз.

Что именно определяется в процессе анализа?

В процессе анализа врач просматривает препараты кала пациента под микроскопом, визуально определяя наличие яиц и частей тел паразитов.

Что означают результаты теста?

Положительный результат анализа — «обнаружено» выдается, когда выявлены яйца гельминтов, цисты простейших или непосредственно сами паразиты.

Результат «не обнаружено» не исключает наличия паразитарного заболевания, так как выделение яиц гельминтов зависит от фазы их размножения. При наличии симптомов и отрицательном результате теста нужно сделать повторное исследование. При небольшом количестве яиц паразитов в кале более информативным может быть тест нового поколения – исследование кала на простейшие и яйца гельминтов методом обогащения (PARASEP).

Обычный срок выполнения теста

Обычно результат анализа на гельминтов и простейших можно получить в течение 1-2 дней.

Нужна ли специальная подготовка к анализу?

Для выявления простейших кал должен быть свежим, собран непосредственно перед сдачей материала в лабораторию. Яйца гельминтов стабильны, сохраняются в кале долгое время.

Браунодин® мазь

Антимикробный эффект Браунодина связан с выделением свободного йода при контакте с кожей, слизистой оболочкой и поверхностью раны, и зависит не от концентрации раствора повидон-йода, а от концентрации свободного йода, со держание которого в Браунодине 22 мг/л,что гораздо больше чем у аналогичных препаратов повидон-йода. Браунодин — антибактериальное средство, к которому отсутствует резистентность болезнетворных микроорганизмов от вирусов до простейших: даже в разведении 1/2000 он разрушает все вегетативные формы бактерий. Среднее время антимикробного воздействия повидон-йода на микроорганизмы: грамположительные и грамотрицательные бактерии — 15–30 секунд; вирусы — 15 секунд; грибы — 15–30 секунд; простейшие (трихомонады) — 30–60 секунд.

Браунодин представляет собой депо йода. За счет постепенного высвобождения йода из комплекса повидон-йод действует длительно. Благодаря большому размеру комплексной молекулы, он не проникает через биологические барьеры, поэтому системное действие йода отсутствует. Браунодин за счет своего осмотического действия снимает отеки и уменьшает воспаление тканей. Проведение ирригации раневой полости водным раствором повидон-йода во время хирургической операции и перед наложением швов на операционную рану является одной из рекомендаций ВОЗ по профилактике инфекции в области хирургического вмешательства. Эти свойства делают Браунодин незаменимым местным антисептиком в неотложной хирургии.

Выпускается в форме тубы объемом 20, 100и 250 мг.

Преимущества

Широкий спектр действия: антибактериальный, противовирусный, противогрибковый, а также антипротозойный

  • Активен против спор бактерий
  • Отсутствие резистентности к препаратуу микроорганизмов
  • Максимальная эффективность достигается в течении 15 секунд
  • Не обладает раздражающим действием при применении на слизистые и раны
  • Эффективен при значении pH от 2 до 7

Показания

Обработка кожи операционного поля и слизистых до и после операции.

  • Лечение ожогов и донорских ран
  • Лечение инфицированных ран, в том числе посттравматических и послеоперационных ран
  • Трофические язвы различного происхождения
  • Гнойно-некротические раны и пролежней
  • Инфекции кожи различной этиологии: инфекционный дерматит и экзема, рожистое воспаление, абсцесс кожи, фурункул и карбункул, флегмона, пиодермия
  • Микозы и кандидозы кистей, стоп, кожи туловища

Общая характеристика простейших — урок. Биология, Животные (7 класс).

Царство Животные делится на два подцарства: Одноклеточные и Многоклеточные.

 

Одноклеточные животные состоят из одной клетки. Поэтому другое их название — Простейшие.

 

Поскольку клетка очень мала, простейших сложно увидеть невооружённым глазом, но их очень много. Насчитывается около \(70\) тыс. видов одноклеточных животных (или простейших). К ним относятся амёба, инфузория-туфелька, радиолярия и др.

  

Единственная клетка простейшего живёт как целостный организм.

В ней осуществляются все жизненно важные функции животного: движение, питание, дыхание, выделение, обмен веществ, раздражимость, размножение.

 

Рассмотрим строение и функции такой клетки на примере амёбы обыкновенной.

 

Для амёбы характерны все признаки животной клетки: клеточная мембрана, внутри которой находится цитоплазма с ядром, органеллами и включениями.

 

Обрати внимание!

Наличие в клетке ядра свидетельствует о том, что амёба относится к эукариотам.

Клетка амёбы не имеет постоянной формы.

Полужидкая цитоплазма внутри клетки может перетекать и приводить к выпячиванию клеточной мембраны наружу (рисунок \(1\)).

Так образуются ложноножки, или псевдоподии, с помощью которых амёба передвигается.

У некоторых других простейших имеются реснички и жгутики для более быстрого передвижения.

  

С помощью псевдоподий амёба может захватывать мельчайшие частички пищи (других одноклеточных). Окружая пищу, псевдоподии сближаются и плотно обхватывают её.  Так внутри клетки образуется пищеварительная вакуоль (рисунок \(1\)), в которой происходит переваривание захваченной пищи.

 

Обрати внимание!

Как и большинство животных, амёба питается готовыми органическими веществами, поэтому относится к гетеротрофам.

 

Рис. \(1\). Вакуоли

 

Обрати внимание!

Псевдоподии обеспечивают передвижение и захват пищи.

В клетке амёбы есть сократительные вакуоли (рисунок \(1\)). Они помогают

организму простейших выводить избыток воды, ненужные и вредные вещества.

Вакуоль — это полость в цитоплазме клетки, имеющая мембрану и жидкость с растворёнными веществами.

Обрати внимание!

Амёбе свойственна раздражимость — способность реагировать на изменения окружающей среды. Реакции в виде движения по направлению к источнику раздражения или в противоположную сторону называют таксисами. Движение к раздражителю — положительный таксис, от раздражителя — отрицательный таксис.

Амёбе характерно бесполое размножение.

При этом клетка делится на две подобные клетки. Сначала в клетке делится ядро, затем — цитоплазма с остальным содержимым. 

   

Рис. \(2\). Процесс деления клетки надвое

  

У других простейших бывает деление клетки на две или больше клеток (множественное деление, или шизогония). Деление может быть поперечным (например, у инфузории-туфельки) или продольным (например, у эвглены зелёной).

У некоторых простейших есть половое размножение. 

 

Амёба приспособлена к жизни в жидкой среде. В неблагоприятных обстоятельствах (высыхании, резком изменении температур) на поверхности простейших образуется

плотная оболочка, и они превращаются в особую форму — цисту (рисунок \(3\) А).

Образование цисты — способ выживания в неблагоприятных условиях.

Рис. \(3\). Циста амёбы

 

При наступлении благоприятных условий (рисунок \(3\) Б) амёба покидает защитную оболочку цисты и продолжает свою жизнедеятельность.  

Источники:

Рис. 1. Вакуоли. © ЯКласс.

Рис. 2. Процесс деления клетки надвое. © ЯКласс.

Рис. 3. Циста амёбы. © ЯКласс.

Биология клетки — Департамент физической культуры и спорта

В. Н. Селуянов, В. А. Рыбаков, М. П. Шестаков

Глава 1. Модели систем организма

1.1.1. Биология клетки

Клетка — основная структурная единица всех живых организмов, элементарная живая целостная система, которая обладает рядом свойств: воспроизведение, синтез (анаболизм), катаболизм, производство энергии, поглощение, выделение, специфические функции.

Она представляет собой протоплазму, окруженную мембраной. В протоплазме расположено ядро, в котором содержится гены (наследственная информация) в виде молекул ДНК. В протоплазме имеются следующие структурные образования, их еще называют органеллами или органоидами:

    — рибосомы (полирибосомы) — с помощью РНК производится строительство белка, иными словами, разворачиваются анаболические процессы;

    — митохондрии — энергетические станции клетки, в них с помощью кислорода идет превращение жиров или глюкозы в углекислый газ (СО2), воду и энергию, заключенную в молекулах АТФ;

    — эндоплазматическая сеть — или саркоплазматический ретикулум является органеллой, состоящей из мембран и ферментативных систем, прикрепленных к ней;

    — комплекс Гольджи — система мембран, образующих совокупность мешочков и пузырьков, служит для синтеза и выделения веществ из клетки;

    — лизосомы — органеллы в форме пузырьков, содержат ферменты, разрушающие белки до простейших составляющих аминокислот, эти органеллы еще называют пищеварительным аппаратом клетки;

    — глобулы гликогена — источник углеводов в клетке;

    — капельки жира — источник жиров в клетке;

    — специализированные органеллы — структурные компоненты клетки, присущие определенным видам клеток, например, миофибриллы мышечным волокнам.

В клетке разрешается главное противоречие — основа жизнедеятельности, динамическое равновесие между процессами анаболизма и катаболизма. Анаболизм связан с функционированием наследственного аппарата клетки, который управляет синтезем новых органелл, а лизосомы отвечают за катаболизм — разрушение органелл клетки, который существенно усиливается при повышении концентрации ионов водорода в цитоплазме.

Важно заметить, что все процессы анаболизма предопределяются стероидными гормонами. Они соединяются с рецепторами на мембранах клетки, образуют ансамбль «гормон-рецептор», который проникает в ядро и вызывает транскрипцию (расшифровку и считывание) наследственной информации. Так происходит управление анаболизмом. Катаболизм в клетке связан с активностью лизосом, лизосомы усиливают активность с ростом концентрации ионов водорода. В ходе физических упражнений образуется молочная кислота, именно она является ускорителем катаболизма в клетках.



(PDF) ЖИЗНЕСПОСОБНЫЕ ПРОСТЕЙШИЕ В ВЕЧНОЙ МЕРЗЛОТЕ АРКТИКИ VIABLE PROTISTS IN ARCTIC PERMAFROST

77

ЖИЗНЕСПОСОБНЫЕ ПРОСТЕЙШИЕ В ВЕЧНОЙ МЕРЗЛОТЕ АРКТИКИ

Условия погребения цист простейших и ре-

жим их криоконсервации, по нашему мнению, яв-

ляются важнейшими факторами, от которых за-

висит биоразнообразие и численность “живых

ископаемых” простейших.

Авторы выражают благодарность А.П. Мыль-

никову (Институт биологии внутренних вод РАН,

Борок) за помощь в подготовке работы.

Литература

Бобров А.А., Зигерт К., Ширмейстер Л., Андреев А.А.

Раковинные амебы (Protozoa: Testacea) в четвертичных от-

ложениях полуострова Быковский, арктическая Якутия //

Изв. РАН. Сер. биол., 2003, № 2, с. 236–253.

Вишнивецкая Т.А., Ерохина Л.Г., Гиличинский Д.А.,

Воробьева Е.А. Синезеленые и зеленые водоросли из веч-

номерзлых осадочных пород Арктики // Криосфера Земли,

1997, т. I, № 2, с. 71–76.

Гиличинский Д.А., Хлебникова Г.М., Звягинцев Д.Г. и др.

Микробиологические характеристики при изучении оса-

дочных пород криолитозоны // Изв. АН СССР. Сер. геол.,

1989, № 6, с. 103–115.

Губин С.В. Позднеплейстоценовое почвообразование на

Приморских низменностях севера Якутии // Почвоведение,

1994, № 8, с. 5–14.

Губин С.В. Педогенез – составная часть механизма фор-

мирования отложений позднеплейстоценового ледового

комплекса // Криосфера Земли, 2002, т. VI, № 3, с. 82–91.

Губин С.В., Занина О.Г., Максимович С.В. и др. Рекон-

струкция условий формирования отложений ледового ком-

плекса по результатам изучения позднеплейстоценовых нор

грызунов // Криосфера Земли, 2003, т. VII, № 3, с. 13–22.

Дмитриев В.В., Гиличинский Д.А., Файзутдинова Р.Н.

и др. Дрожжи в вечномерзлых отложениях Сибири позд-

неплейстоценового–раннеплейстоценового возраста //

Криосфера Земли, 1997, т. I, № 2, с. 67–70.

Жуков Б.Ф. Атлас пресноводных гетеротрофных жгутико-

носцев (биология, экология, систематика). Рыбинск, Ин-т

биологии внутр. вод РАН, 1993, 160 с.

Занина О.Г. Ископаемые норы грызунов из мерзлых отло-

жений Колымской низменности // Зоол. журн., 2005, т. 6,

вып. 85, с. 728–736.

Звягинцев Д.Г., Гиличинский Д.А., Благодатский С.А. и др.

Длительность сохранения жизнеспособных микроорганиз-

мов в постоянно мерзлых осадочных породах и погребенных

почвах // Микробиология, 1985, т. 54, с. 153–163.

Каптерев П.Н. Об анабиозе в условиях вечной мерзлоты //

Изв. АН СССР. Сер. биол., 1936, № 6, с. 1073–1088.

Каптерев П.Н. Новые материалы по оживлению организ-

мов из вечной мерзлоты // Докл. АН СССР, 1938, вып. 20,

№ 4, с. 315.

Кочкина Г.А., Иванушкина Н.Е., Карасев С.Г. и др. Выжи-

вание микромицетов и актинобактерий в условиях длитель-

ной природной криоконсервации // Микробиология, 2001,

т. 70, № 3, с. 412–420.

Лозина-Лозинский Л.К. Очерки по криобиологии (адапта-

ция и устойчивость организмов и клеток к низким и сверх-

низким температурам). Л., Наука, 1972, 288 с.

Микрюков К.А. Центрохелидные солнечники (Centrohelio-

zoa). М., КМК, 2002, 136 с.

Полянский Ю.И., Суханова К.М., Карпов С.А. Основные

характеристики протистов // Протисты: Рук-во по зооло-

гии / Ред. А.Ф. Алимов. СПб., Наука, 2000, ч. 1, с. 145–184.

Ривкина Е.М., Краев Г.Н., Кривушин К.В. и др. Метан в

вечномерзлых отложениях северо-восточного сектора Арк-

тики // Криосфера Земли, 2006, т. X, № 3, с. 23–41.

Спирина Е.В., Федоров-Давыдов Д.Г. Микробиологичес-

кая характеристика мерзлотных почв Колымской низмен-

ности // Почвоведение, 1998, № 12, с. 1462–1475.

Суханова К.М. Температурные адаптации у простейших.

Л., Наука, 1968, 267 с.

Томирдиаро С.В. Лёссово-ледовая формация Восточной

Сибири в позднем плейстоцене и голоцене. М., Наука, 1980,

183 с.

Хлебникова Г.М., Гиличинский Д.А., Федоров-Давы-

дов Д.Г., Воробьева Е.А. Количественная оценка микро-

организмов в мерзлых осадках и погребенных почвах //

Микробиология, 1990, т. 59, с. 148–155.

Шатилович А.В., Мыльников А.П., Ступин Д.В. Фауна и

морфология гетеротрофных жгутиконосцев и солнечников

позднеплейстоценовых ископаемых нор сусликов (Колым-

ская низменность) // Зоол. журн., 2010 (в печати).

Шатилович А.В., Шмакова Л.А., Гудков А.В. и др. Жизне-

способные Protozoa из вечномерзлых отложений и погребен-

ных почв // Докл. РАН, 2005, т. 401, № 5, с. 715–717.

Яшина С.Г., Губин С.В., Шабаева Э.В. и др. Жизнеспо-

собность семян высших растений позднеплейстоценового

возраста из вечномерзлых отложений // Докл. РАН, 2002,

т. 383, № 5, с. 714–717.

Auer B., Arndt H. Taxonomic composition and biomass of

heterotrophic flagellates in relation to lake trophy and season //

Freshwater Biol., 2001, vol. 46, p. 959–972.

Chavez-Munguia B., Omana-Molina M., Gonzalez-Lazaro M.

et al. Ultrastructural stady of encystations and excyatation

in Acanthamoeba castellanii // J. Eukaryot. Microbiol., 2005,

vol. 52, No. 2, p. 1–6.

Clegg J.S. Cryptobiosis – a peculiar state of biological organiza-

tion // Comp. Biochem. Physiol., 2001, No. 128, p. 613–624.

De Jonckheere J. Isolation and molecular identification of free-

living amoebae of the genus Naegleria from Arctic and sub-An-

tarctic regions // Europ. J. Protistol., 2006, No. 42, p. 115–123.

Ekelund F., Patterson D.J. Some heterotrophic flagellates from

a cultivated garden soil in Australia // Arch. Protistenkd., 1997,

vol. 148, p. 461–478.

Faizutdinova R., Suzina N., Duda V. et al. Yeasts Isolated from

Ancient Permafrost // Life in Ancient Ice. Princeton, Princeton

Univ. Press, 2005, ch. 8, p. 118–126.

Foissner W. Basic light and scanning electron microscopic

methods for taxonomic studies of ciliated protozoa // Europ. J.

Protistol., 1991, No. 27, p. 313–330.

Foissner W. Estimating the species richness of soil protozoa

using the “non-flooded petri dish method” // Protocols in

Protozoology. Kansas, Allen Press Lawrence, 1992, p. B-

10.1–B-10.2.

Foissner W. Copodea (Ciliophora) // Protozoenfauna.

Stuttgart, Jena, N.Y., Gustav Fischer Verlag, 1993, 777 p.

Foissner W. Faunistics, taxonomy and ecology of moss and soil

ciliates (Protozoa, Ciliophora) from Antarctica, with description

of new species, including Pleuroplitoides smithi gen. n., sp.n. //

Acta Protozoologica, 1996, No. 35, p. 95–123.

Gilichinsky D. Permafrost model of extraterrestrial habitat //

Astrobiology. Berlin, Springer-Verlag, 2002, p. 271–295.

Выделение простейших из воды, связанное со вспышкой легионеллеза, и демонстрация внутриклеточного размножения Legionella pneumophila.

Appl Environ Microbiol. 1986 г., февраль; 51(2): 422–424.

Эта статья была процитирована другими статьями в PMC.

Реферат

На месте вспышки легионеллеза амебы и две инфузории Tetrahymena sp. и Cyclidium sp., были выделены из воды градирни, содержащей Legionella pneumophila. Tetrahymena sp.и амебы неоднократно демонстрировали способность поддерживать внутриклеточное размножение L. pneumophila. Оба были изолированы от градирен, которые были конкретно замешаны в распространении легионеллеза. Эти простейшие могут быть резервуарами, поддерживающими выживание и размножение вирулентных легионелл в воде градирни.

Полный текст

Полный текст доступен в виде отсканированной копии оригинальной печатной версии. Получите копию для печати (файл PDF) полной статьи (713K) или щелкните изображение страницы ниже, чтобы просмотреть страницу за страницей.Ссылки на PubMed также доступны для Selected References .

Изображения в этой статье

Нажмите на изображение, чтобы увеличить его.

Избранные ссылки

Эти ссылки находятся в PubMed. Возможно, это не полный список литературы из этой статьи.

  • Ананд К.М., Скиннер А.Р., Малик А., Курц Д.Б. Взаимодействие L. pneumophilia и свободноживущей амебы (Acanthamoebapalestinensis). J Hyg (Лондон), 1983, октябрь; 91 (2): 167–178.[Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Bopp CA, Sumner JW, Morris GK, Wells JG. Выделение Legionella spp. из проб воды из окружающей среды путем обработки с низким уровнем pH и использования селективной среды. Дж. Клин Микробиол. 1981 г., апрель; 13 (4): 714–719. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • England AC, 3rd, Fraser DW, Mallison GF, Mackel DC, Skaliy P, Gorman GW. Неспособность предсказать чувствительность Legionella pneumophila к культуре возникает из-за обработанных дезинфицирующим средством градирен кондиционирования воздуха.Appl Environ Microbiol. 1982 г., январь; 43 (1): 240–244. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Fields BS, Shotts EB, Jr, Feeley JC, Gorman GW, Martin WT. Пролиферация Legionella pneumophila как внутриклеточного паразита реснитчатого простейшего Tetrahymena pyriformis. Appl Environ Microbiol. 1984 г., март; 47 (3): 467–471. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Garbe PL, Davis BJ, Weisfeld JS, Markowitz L, Miner P, Garrity F, Barbaree JM, Reingold AL. Внутрибольничная болезнь легионеров.Эпидемиологическая демонстрация градирен как источника. ДЖАМА. 1985 г., 26 июля; 254 (4): 521–524. [PubMed] [Google Scholar]
  • GIMENEZ DF. ОКРАШИВАНИЕ РИККЕТСИЙ В ЖЕЛТОЧНЫХ КУЛЬТУРАХ. Технология окрашивания. 1964 г., май; 39: 135–140. [PubMed] [Google Scholar]
  • Грейс Р.Д., Дьюар Н. Е., Барнс В.Г., Ходжес Г.Р. Чувствительность Legionella pneumophila к трем микробицидам градирен. Appl Environ Microbiol. 1981 г., январь; 41 (1): 233–236. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Паскулль А.В., Фили Дж.С., Гибсон Р.Дж., Кордес Л.Г., Майеровиц Р.Л., Паттон К.М., Горман Г.В., Кармак К.Л., Эззелл Д.В., Доулинг Д.Н.Возбудитель питтсбургской пневмонии: прямое выделение из ткани легких человека. J заразить Dis. 1980 г., июнь; 141 (6): 727–732. [PubMed] [Google Scholar]
  • Rowbotham TJ. Предварительный отчет о патогенности Legionella pneumophila для пресноводных и почвенных амеб. Джей Клин Патол. 1980 декабрь; 33 (12): 1179–1183. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Soracco RJ, Gill HK, Fliermans CB, Pope DH. Восприимчивость водорослей и Legionella pneumophila к биоцидам градирен. Appl Environ Microbiol.1983 г., апрель; 45 (4): 1254–1260. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • WHEATLEY WB. Процедура быстрого окрашивания кишечных амеб и жгутиконосцев. Ам Джей Клин Патол. 1951 г.; 21 (10) октября: 990–991. [PubMed] [Google Scholar]

Здесь представлены статьи по прикладной и экологической микробиологии, любезно предоставленные Американским обществом микробиологии (ASM)


Оптимизация и валидация методов выделения и ПЦР-идентификации ооцист простейших в реальном времени на листовых зеленых овощах и ягодных фруктах

Листовые зеленые овощи и ягодные фрукты имеют совершенно разные физические и биохимические характеристики, обычно употребляются в сыром виде с минимальным мытьем и являются потенциальными переносчиками болезней пищевого происхождения, вызываемых простейшими паразитами, такими как Cryptosporidium , Циклоспора и Токсоплазма .Валидация общего метода выделения и обнаружения ооцист, применимого к каждому виду листовой зелени и ягод, необходима для обеспечения надежной лабораторной поддержки программ эпиднадзора и, при необходимости, для расследований вспышек заболеваний. Целями настоящего исследования были оптимизация и проверка эффективности этих методов для выделения ооцист простейших из нескольких видов листовой зелени и ягод. Ооцисты Eimeria papillata использовались в качестве заменителя кокцидий, представляющих опасность для общественного здравоохранения, для внесения в пробы продукции.Использовали искусственный стостер или орбитальный шейкер с последующим центрифугированием для выделения и концентрирования ооцист, соответственно, а для обнаружения и идентификации использовали анализ кривой плавления qPCR (qPCR MCA). Методы обработки, промывочные буферы и условия хранения были оценены и оптимизированы для пяти видов ягод (ежевика, черника, клюква, малина и клубника), пяти видов трав (кинза, укроп, мята, петрушка, тимьян) и зеленого лука. Ежевика, клюква, малина и земляника наиболее эффективно промывались при орбитальном встряхивании с элюирующим раствором, тогда как глициновый буфер был более эффективен для черники.Желудок с глициновым буфером был оптимальным для извлечения ооцист у листовых трав с мягкими стеблями, в то время как ароматические травы с древесными стеблями, такие как тимьян, требовали орбитального встряхивания, чтобы свести к минимуму высвобождение ингибиторов ПЦР. Извлечение ооцист из зеленого лука было самым высоким при обработке путем орбитального встряхивания с раствором для элюирования. Показатели извлечения ооцист варьировали от 4,1–12% для ягод и 5,1–15,5% для трав и зеленого лука. Всего 3 ооцисты на грамм фруктов или 5 ооцист на грамм трав или зеленого лука можно надежно обнаружить с помощью оптимизированных методов выделения и количественной ПЦР MCA.

Выделение и обнаружение простейших пищевого происхождения


1

2

Протазоа и снижение популяций ризобия, добавлено в почву

, цитируемые

2. Метаанализ эффективности различные инокулянты ризобий на признаки сои в полевых условиях

3. Питательная добавка из соснового биоугля для использования в качестве носителя бактериального инокулята

4. Влияние минеральных коллоидов почвы на процессы метаболизма, рост, адгезию и экологию микробов и вирусов

5. Дарвиновский взгляд на повышение эффективности азотфиксации бобовых культур и кормов

6. Life History of Symbiotics Ризобиальные и микоризные грибы

7. Идентификация Неглерия фоулери в теплых подземных водоносных горизонтах

8. Альтернативный образ жизни ризобий: мутуализм, паразитизм и отказ от симбиоза

9. Выживаемость и устойчивость генетически модифицированных Sinorhizobium meliloti в почве

10. Факторы, влияющие на эффективность симбиотической азотфиксации Rhizobium

11. Усиленный рост и заселение клубеньков красной фасоли и фасоли, инокулированной на почве инокулянт

12. Использование штамма Moraxella, меченого зеленым флуоресцентным белком, разлагающего п-нитрофенол, для изучения защитного действия альгинатной инкапсуляции против поедания простейших

13. Снижение выживаемости штамма Sinorhizobium meliloti с дефицитом RecA в стерильной и нестерильной почве при тепловом стрессе

14. Интенсификация земледелия, биоразнообразие почв и экосистемные функции в тропиках: роль азотфиксирующих бактерий

15 Распространение бактерии (γ-1,2,3,4,5,6-гексахлорциклогексан-разлагающей Сфингомонас маломобильный ) среди почвенных агрегатов

16. Факторы, влияющие на заселение клубеньков инокулянтом Rhizobia

17. Влияние свойств почвы и истории выращивания сои на популяцию Bradyrhizobium japonicum в некоторых почвах Франции почв, инкубированных с 14C, 15N-меченой глюкозой/Nh5 и остатками соломы бобовых и пшеницы

20. Экологическое применение иммобилизованных микробных клеток: обзор

21. Взаимодействие генетически модифицированного Pseudomonas fluorescens с почвоядным дождевым червем Octolasion cyaneum (Lumbricidae)

22. Примечания по простейшим в сельскохозяйственных почвах с акцентом на гетеротрофных жгутиконосцах и голых амебах и их экологии

03. Контрольный выпуск иммобилизованных клеток как стратегия регулирования экологической компетентности инокулята

24. Выживание бактерий в почве: влияние глин и простейших

25. Выщелачивание генетически модифицированных Pseudomonas fluorescens через микрокосмы неповрежденной почвы: влияние типа почвы

26. Выщелачивание генетически модифицированных Pseudomonas fluorescens через органические почвы: влияние температуры, рН почвы и корней

25. 9007 Различия в динамике между аборигенным и инокулированным штаммом Sphingomonas paucimobilis SS86 в почвах

28. Различия в динамике между аборигенным и инокулированным штаммом Sphingomonas paucimobilis SS86 в почвах

29. Усиление бактериального метаболизма штамма Pseudomonas в ответ на добавление культурального фильтрата амебы-бактериофага в почву: гипотеза амебного хищничества

32. Регулирование Фузариоз оксиспорум популяция, интродуцированная в почву: гипотеза амебного хищничества

33. Влияние грибковых корневых патогенов на динамику популяции штаммов биоконтроля флуоресцентных псевдомонад в ризосфере пшеницы

34. Сравнение методов определения численности хищных бактерий, атакующих Chromatiaceae

35. Факторы воздействия Информация среди микроорганизмов в почве

36. Выживание ризобий фасоли с мутацией Tn5 в почвах пустынь: фенотипическая экспрессия Tn5 в условиях дефицита влаги

37. Ускорение оборота углерода и стимуляция предварительного эффекта для хищничества в гумусе леса

40. Почвенный агрегат как благоприятная среда обитания для Bradyrhizobium japonicum штаммы

41. Predation et lutte microbiologique.Potentialités de ľassociation protozoaires-microflore

42. Рост и выживание бактерий, интродуцированных в обогащенную углеродом почву

43. Исследование 33 бактериофагов Rhizobium meliloti

44. Влияние бактериофага на колонизацию корней сахарной свеклы флуоресцентным псевдомонада spp

45. Поедание простейшими бактериальных клеток в почвенных агрегатах

46. Фракционирование и оценка присоединенных и неприкрепленных частиц Bradyrhizobium japonicum Деформации в почвах

47. Потенциал ризобий Улучшение

48. Влияние влаги и солевого стресса на отдельные штаммы Rhizobium Phaseoli

49. Экологические ограничения на фиксацию азота в сельскохозяйственных экосистемах

50. Минимальная плотность бактерий для бактериофагов природные экосистемы

51. Снижение доли phe клеток, способных индуцировать клубеньки в популяции ризобиум японский интродуцирован в почву

52. Взаимодействие ризобий сп. с токсин-продуцирующим грибком в культуральной среде и в тропической почве

53. Возникновение и распространение патогенных свободноживущих амеб в термальных районах Северного острова Новой Зеландии

54. Выживание штамма миксобактерий 8 в естественной почве в присутствии и отсутствии клеток-хозяев

55. Судьба в модельных экосистемах видов микробов, потенциально пригодных для использования в генной инженерии

56. Выживание ризобий в кислых почвах

57. Значение и применение Rhizobium в сельском хозяйстве

59. Влияние простейших на бактериальное разложение ароматического соединения

60. Влияние простейших на бактериальное разложение ароматического соединения

61. Rhizobia тропических бобовых — XI. Выживание в среде семян

62. Факторы, влияющие на выживание ризобия в почве

63. Роль простейшей в питательном велосипеде и потоке энергии

64. Дисфункция и дефицит в симбиотических ответах

65 Механизмы сохранения небольшого количества бактерий, на которые охотятся простейшие

66. Протозоа по отношению к Rhizobium S-12 и AzotoBacter Hroococcum в почве

67. Сопротивление кисты амебы до микробного разложения

68. Гсирование Escherichia Coli от Colpoda STEINII

(PDF) Изоляция и идентификация Паразитические простейшие в пробах воды с юго-запада Ирана

Rafiei A et al.

3

Jundishapur J Health Sci. 2014;6(4):e23462

5. Обсуждение

В мире существует множество исследований по оценке паразитарного

загрязнения водных источников.Недавно

Robertson в Норвегии (11, 12), Ono в Японии (13), Briancesco

в Италии (14), Azman в Малайзии (15), Gracenea в Испании (10),

Khouja в Тунисе (7 , 16), Аяз в Пакистане (3), Бакир в Ан-

кара (9), Хайду в Швеции (17), Басуальдо в Аргентине (18),

Фариас в Бразилии (19), Плутцер в Венгрии (20 ) и Nichols

в Соединенном Королевстве (21) провели исследования по обнаружению паразитарного заражения воды. В Иране было проведено несколько исследований

в различных провинциях и городах

, Мазендаране (Зиаи) (22), Чахрмахал ва бахтьяри

(Наэйни) (23), Урумие (Нанбахш) (24) и Кашане

( Расти) (25). Текущее исследование показывает, что цисты видов Entamoeba

преобладали во всех пробах воды района

Ахваза, что согласуется с исследованием Ziaei (22)

из Мазандарана и Аяза (3) из Пакистана. Эти находки положительно коррелировали с клиническими лабораторными

отчетами из Ахваза, согласно которым Entamoeba his-

tolytica преобладали над другими простейшими

патогенами в желудочно-кишечном тракте пациентов.Второй наиболее частой инфекцией была инфекция, вызванная Crypto-

sporidium spp, которая была обнаружена в большинстве положительных образцов.

Результаты согласовывались с исследованиями Ayaz и Robertson

из Пакистана и Норвегии (3, 12), но не согласовывались с результатами исследования Ziaei из Мазан-

даран (22). Кроме того, мы обнаружили Blastocystis spp в шести образцах из 44 (13,63%). Отсутствовала информация о заражении

Blastocystis проб воды из Ирана.

Низкий процент проб воды был контаминирован

цистами Giardia, что не согласуется с другими исследованиями, проведенными в Иране и других частях мира (22). В

этом исследовании все образцы из реки Карун были контаминированы простейшими паразитами. Хотя цисты Giardia

не были выделены из речных проб, тем не менее, в некоторых пробах водопроводной воды

цисты Giardia были обнаружены. Briancesco из Италии

обнаружил несколько цист Giardia в пробах сырой воды

(14).Это несоответствие может быть связано с малым количеством собранных образцов в этом исследовании. Согласно этому исследованию

вода, поступающая на водоочистные сооружения, имела низкое санитарное

качество. Три пробы очищенной воды были заражены

паразитами, что указывало на неадекватность используемых методов очистки

для очистки воды. Трофозоиты

чувствительны к большинству дезинфицирующих средств, но цисты и ооцисты

остаются устойчивыми к хлорированию и обработке озоном.

Таким образом, физическое удаление Giardia, цист Entamoeba

и ооцист Cryptosporidium с помощью многочисленных барьеров очень важно (8). В Ахвазе большинство источников питьевой воды

получают из поверхностных вод, которые могут быть легче

заражены простейшими паразитами животных и

человека. С другой стороны, близость водопроводной системы

к канализации, водопроводной сети

старше 30 лет и использование водяных насосов

повышает давление воды во многих домах, вызывая вакуум

и откачивал сточные воды из сломанной водопроводной системы.

Кроме того, река Карун загрязнена промышленными

сточными водами и сточными водами больниц.

загрязнение питьевой воды паразитарными агентами

не было показано Briancesco из Италии (14), Bakir из

Анкары (9) и исследователями из других развитых стран

однако Ayaz сообщил о заражении питьевой воды в Пакистане ( 3).

Паразитические агенты не были обнаружены в поставляемой на рынок воде

из-за соответствующих методов фильтрации.Заражение гельминтозами

не наблюдалось во всех исследованных пробах воды, и этот вывод

согласуется с исследованием Ziaei из Мазандарана (22),

Khouja из Туниса (7), Ayaz из Пакистана (3) и Bakir

из Анкара (9). Отчет местной медицинской лаборатории

о заражении гельминтами показал значительное снижение

этой инфекции в Ахвазе за последние годы. Текущие данные

коррелируют с недавними сообщениями о вспышках паразитов, передающихся через воду

, которые показывают, что большинство

паразитов были простейшими (97.7%) (6, 26). Проведенное исследование показало, что гигиеническое качество воды в исследуемом районе

неудовлетворительное. Ряд исследований показал,

, что и Giardia, и Cryptosporidium

растворяются не только в водопроводной воде, но и в бутилированной воде (4). Установлено, что

циста амебы Ent-

, передающийся через воду патогенный паразит, является причиной серьезных вспышек в этом районе. Виды Giardia spp , Cryptosporidium spp , Entamoeba spp и

Blastocystis spp в пробах воды представляют собой потенциальный риск инфекции

у людей.

Текущее исследование показало, что уровень заражения паразитарными

инфекциями в питьевой воде значительно выше.

огнеупорная система организации водоснабжения должна быть защищена с использованием эффективных методов дезинфекции, а

реконструкция водопроводной сети должна быть рассмотрена

. До достижения этих целей персональная защита

должна осуществляться с использованием систем домашней фильтрации.

Кроме того, для определения сезонного характера загрязнения воды рекомендуется использовать молекулярные методы

для точной идентификации паразитов.

Благодарности

Мы выражаем особую благодарность сотрудникам Управления здравоохранения Ахваз-Вест-

за помощь в сборе проб воды из рек, домов

и розничных торговцев водой.

Список литературы

1. Дура Г., Камбурова В., Симеонова Ф., Программа НАТО по безопасности через науку. Управление преднамеренным и случайным загрязнением воды

. : Спрингер; 2006.

2. Lv S, Tian LG, Liu Q, Qian MB, Fu Q, Steinmann P, et al.Передаваемые через воду

паразитарные заболевания в Китае. Общественное здравоохранение Int J Environ Res.

2013; 10 (5): 1977–2016.

3. Аяз С., Хан С., Хан С.Н., Биби Ф., Шамас С., Ахтар М. Распространенность

зоонозных паразитов в питьевой воде трех районов

провинции Хайбер-Пахтунхва, Пакистан. Пакистан J Life Soc Sci.

2011; 9 (1): 67–9.

4. Каранис П. Обзор появляющихся паразитарных простейших, передающихся через воду.Jpn J Protozool. 2006 г.; 39 (1).

5. Краун М.Ф., Краун Г.Ф., Кальдерон Р.Л., Бич М.Дж.

случаев передачи через воду в США. J Здоровье воды. 2006 г.; 4 (Sup-

pl 2): ​​19–30.

6. Зарленга Д.С., Траут Ю.М. Концентрация, очистка и обнаружение

паразитов, передающихся через воду. Вет Паразитол. 2004 г.; 126 (1-2): 195–217.

7. Ходжа Л.Б., Кама В., Сяо Л. Паразитарное заражение сточных вод —

Сопутствующее выделение первичных астроцитов и микроглии для заражения простейшими паразитами

Общая цель этого протокола состоит в том, чтобы проинструктировать, как извлекать, поддерживать и диссоциировать мышиные астроциты и клетки микроглии из центральной нервной системы с последующим заражением простейшими паразитами.

В этом протоколе описывается метод, направленный на параллельное выделение двух наиболее распространенных популяций глиальных клеток, астроцитов и микроглии, у постнатальных мышей. Наш метод отличается от других ранее описанных протоколов выделения астроцитов и микроглии, поскольку мы фокусируемся на получении и выделении обоих типов клеток в одной и той же экстракции в одних и тех же условиях, оптимизируя, таким образом, использование экспериментальных животных и улучшая изучение относительных ролей этих клеток в иммунологические контексты. Этот протокол может быть полезен для лучшего изучения роли микроглии и астроцитов во многих контекстах и ​​заболеваниях центральной нервной системы, таких как болезнь Альцгеймера, Паркинсона и инфекции, например, простейшие паразиты или вирусы.

Получение и изоляция обоих типов клеток из одной и той же экстракции желательно для оценки сравнительной роли каждого клеточного подмножества в иммунологических контекстах, таких как инфекция или воспаление. Люди должны быть осторожны, особенно во время удаления мозга и промывания нервной ткани, но я верю, что с этим протоколом и видео, люди не будут бороться.Этот протокол может быть длинным в зависимости от количества животных для извлечения коры, поэтому будьте готовы потратить около четырех часов или более.

В первый день приготовьте чистый HBSS и HBSS плюс 10% термоинактивированного FBS. Подготовьте дополненный DMEM F12 и отфильтруйте его с помощью фильтра 0,22 микрона. Стерилизуйте все хирургические инструменты в автоклаве и используйте 70% этанол во время процедуры.

Поместите новорожденных мышей в герметичную камеру, содержащую вату, пропитанную изофлураном, на пять минут для глубокой анестезии.Спрей щенка мыши с 70% этанола и обезглавить животное ножницами. Сделайте сагиттальный разрез ножницами вдоль черепа, чтобы открыть его и обнажить мозг.

Удалите мозг с помощью микрошпателя, чтобы сохранить целостность мозга. Поместите мозг в сухую чашку Петри диаметром шесть сантиметров. Используя микро шпатель, удалите обонятельную луковицу и мозжечок.

Переместите кору в другую чашку Петри, содержащую два миллилитра HBSS плюс 10% FBS. Разрежьте мозговую ткань на мелкие кусочки стерильными ножницами и с помощью микропипетки P1000 перенесите каждую мозговую ткань с HBSS плюс 10% FBS в разные 15-миллилитровые конические пробирки.При необходимости используйте HBSS плюс 10% FBS, чтобы заполнить окончательный объем до двух миллилитров.

Промойте срез ткани головного мозга тремя миллилитрами HBSS плюс 10% FBS для каждой пробирки. После декантации осторожно удалите супернатант. Повторите промывку HBSS плюс 10% FBS еще три раза.

Затем трижды промыть тремя миллилитрами чистого HBSS. После декантации осторожно удалите супернатант. Затем добавьте три миллилитра трипсина и поместите пробирки на водяную баню при температуре 37 градусов Цельсия на 30 минут, осторожно встряхивая пробирки каждые пять минут.

Переваривает собранную ткань. Избегайте пузырей. Чтобы инактивировать трипсин, промойте ткань тремя миллилитрами HBSS плюс 10% FBS и после декантации ткани осторожно удалите супернатант.

Повторите эту промывку три раза. Затем промойте ткань тремя миллилитрами чистого HBSS и повторите еще два раза. После декантации ткани осторожно удалите супернатант.

Добавьте семь миллилитров чистого HBSS и гомогенизируйте ткань последовательными пассажами в пипетках, сначала серологической пипеткой на 10 миллилитров, затем пипеткой на пять миллилитров и, наконец, микропипеткой P1000.После гомогенизации пробирки центрифугируют при 450 g в течение пяти минут при четырех градусах Цельсия. Удалите супернатант и ресуспендируйте осадок с четырьмя миллилитрами HBSS плюс 10% FBS для каждой пробирки.

Перенесите клетки в предварительно обработанную колбу T75 для оптимальной адгезии клеточной культуры. Поместите колбу в инкубатор при 37°С и 5% углекислом газе на 30 минут для прилипания. Затем добавьте в колбу 10 мл DMEM F12 с добавками и инкубируйте в течение двух ночей при 37°С и 5% углекислом газе.

На третий день удалите семь миллилитров культуральной среды из колбы T75 и добавьте семь миллилитров свежей DMEM F12 с добавками. Верните колбу в инкубатор. На пятый день, чтобы удалить мусор и неприлипшие клетки, замените всю среду из колбы T75 14 миллилитрами свежей DMEM F12 с добавками.

Затем каждые 48 часов удаляйте шесть миллилитров супернатанта и добавляйте семь миллилитров свежей среды DMEM F12 с добавками до 14-го дня культивирования. На 14-й день, после удаления шести миллилитров супернатанта и добавления семи миллилитров свежей среды DMEM F12 с добавками, колбы T75 плотно закрывают полиэтиленовой пленкой. Поместите их в напольный орбитальный шейкер при 200 об/мин и 37 градусах Цельсия на ночь, чтобы механически отделить микроглию от астроцитов.

На 15-й день выньте флаконы из шейкера и тщательно промойте их собственной средой, чтобы оптимизировать диссоциацию клеток и собрать максимальное количество микроглии. Затем соберите супернатант и перенесите его в коническую пробирку на 50 мл. Затем добавьте четыре миллилитра трипсина в каждую колбу и инкубируйте в течение пяти минут при 37 градусах Цельсия, чтобы отделить астроциты.

Затем добавьте пять миллилитров DMEM F12 с добавками для инактивации трипсина. Промойте колбы собственной средой и перенесите содержимое в коническую пробирку на 50 мл. Центрифугируйте все пробирки, содержащие диссоциированную микроглию или астроциты, при 450 g в течение пяти минут при четырех градусах Цельсия.

Удалите супернатант. Ресуспензируйте осадок микроглии в одном миллилитре дополненной DMEM F12 и астроциты в 10 миллилитрах дополненной DMEM F12. Приступайте к подсчету клеток в камере Нейбауэра или автоматическом счетчике клеток.

Посейте клетки с добавлением DMEM F12 до нужной плотности в предварительно обработанный планшет для культивирования клеток с плоским дном. Инкубируйте клетки при 37 градусах Цельсия и 5% углекислого газа в течение 24 часов, чтобы они могли прикрепиться. На 14-е сутки культуру глиальных клеток подвергли механической диссоциации.

Наблюдали с чистотой 89,5% для популяции астроцитов и 96,6% для популяции микроглии. Астроциты и микроглию мышей C57BL6 инфицировали T.cruzi Y. Через два часа, 48 часов и 96 часов камеры фиксировали метанолом и окрашивали маркером клеточной нуклеазы DAPI и анти-GFAP.Использование генетически модифицированных паразитов, экспрессирующих флуоресцентные репортеры, или паразитов, меченных специфическими флуоресцентными антителами, улучшило иммунофлуоресцентную микроскопию, поскольку они лучше отличимы от клеточного ядра.

Здесь представлены два примера. Штамм T. gondii RH, конститутивно экспрессирующий YFP, и штамм T.cruzi Y, окрашенный некоммерческим моноклональным антителом 2C2 к белку SSP4. Важно тщательно промыть клетки, чтобы не потерять агрегаты клеток.

После инфицирования глиальных клеток можно оценить другие параметры, такие как ELISA для продукции цитокинов, присутствующих в супернатанте, Вестерн-блоттинг для экспрессии белка и количественная ПЦР в реальном времени для оценки транскрипции РНК.Многие вопросы, связанные с функцией глиальных клеток, например, с их метаболизмом, иммунным ответом и самой клеточной биологией, могут быть решены с помощью этого метода. Все простейшие паразиты способны инфицировать клетки человека, а также культурные клетки мыши, поэтому важно соблюдать осторожность при обращении с этим паразитом.

Границы | Выделение новых бразильских гигантских вирусов из образцов окружающей среды с использованием панели простейших

Введение

Вирусы из предложенного отряда Megavirales были описаны как инфицирующие эукариотических хозяев из разных таксонов (Colson et al. , 2012). Хотя гигантские вирусы фагоцитирующих протистов могут инфицировать самых разных хозяев, каждый вид, по-видимому, обладает специфичностью в отношении хозяина (Colson et al., 2012). Поскольку они были выделены из ограниченного числа простейших, используемых для совместного культивирования, для большинства из них естественный хозяин обычно неизвестен (Colson et al., 2012). Члены двух недавно созданных семейств Mimiviridae и Marseilleviridae были обнаружены и выделены из самых разных сред, включая образцы человека (La Scola et al., 2003, 2008; Бойер и др., 2009 г.; Арслан и др., 2011; Boughalmi et al., 2013a,b,c; Нгунга и др., 2013 г.; Саади и др., 2013a,b; Кампос и др., 2014 г.; Дорнас и др., 2014а; Шейд и др., 2014; Андраде и др., 2015; Ассис и др., 2015; Reteno et al., 2015), и на сегодняшний день с учетом протистических хозяев эти вирусы размножаются только в Acanthamoeba sp. (Ла Скола и др., 2003; Рауль и др., 2004; Колсон и др., 2013). Совсем недавно новый член Megavirales, родственный asfarviridae Faustovirus, был выделен с использованием Vermamoeba vermiformis (VV) для поддержки культуры, демонстрирующей возможное высокое разнообразие между протистами и гигантскими вирусами (Reteno et al. , 2015).

Открытие этих групп гигантских вирусов было отложено, так как до последнего десятилетия традиционные методы выделения вирусов начинались с фильтрации для инокуляции только мелких вирусных частиц и, таким образом, пропускали вирусы размером, сравнимым с бактериями (La Scola et al. , 2003). Первоначально предлагалось концентрирование путем фильтрации с последующим прямым внесением инокулята (La Scola et al., 2008). Впоследствии были добавлены антибиотики в процедуры совместного культивирования амеб с целью снижения бактериального загрязнения (La Scola et al., 2010). Сообщалось также о других методах и модификациях (Arslan et al., 2011; Dornas et al., 2014b). В настоящее время для эффективного выделения гигантских вирусов были разработаны новые методы, сочетающие методы молекулярной биологии с высокопроизводительными стратегиями (Boughalmi et al., 2013a; Pagnier et al., 2013).

Большинство групп использовали Acanthamoeba castellanii (AC) и Acanthamoeba polyphaga (AP) в качестве клеточной поддержки для выделения новых гигантских вирусов (La Scola et al. , 2003; Филипп и др., 2013 г.; Кампос и др., 2014 г.; Ла Скола, 2014; Шайд, 2014; Scheid et al., 2014), но до настоящего времени не сообщалось о сравнении различных амебных носителей. Кроме того, в бразильских образцах на сегодняшний день были выделены только мимивирусы линии А (Campos et al., 2014; Andrade et al., 2015; Assis et al., 2015). Таким образом, целью этой работы было сравнить различные сокультуры с AC, AP , Acanthamoeba griffinii (AG) и VV в качестве клеточной поддержки для поиска новых линий Mimiviridae и других гигантских вирусов в Бразилии. пробы окружающей среды.

Материалы и методы

Образцы

В сентябре 2014 года сто образцов, включая сточные воды, ил, воду, влажную почву и озерные отложения, были собраны в стерильные пробирки из трех разных районов лагуны Пампулья в городе Белу-Оризонти, штат Минас-Жерайс, Бразилия. Образцы были пронумерованы от одного до 100 и хранились при 4°C до процедур инокуляции. Участок 1 – это станция очистки сточных вод, и пробы были собраны до химической обработки сточных вод. В Участке 2 пробы отбирались там, где вода поступает после химической обработки. Третий район (Зона 3) был выбран из-за его удаленности от станции очистки сточных вод. Зона 3 представляет собой изолированную часть лагуны, которая богата органическим веществом и получает только дождевую воду. В этом районе почва находилась на краю озера, снята с самой глубокой части озера (рис. 1).

РИСУНОК 1. Фотографии трех участков, где были взяты пробы окружающей среды, обозначены буквами (A–C).(A) Точка 1, до химической обработки; (Б) Точка 2, после химической обработки; (C) Точка 3, 3 — обособленный участок лагуны (Google Earth).

Обработка образцов

Первоначально образцы были разделены на две группы: одна с водой без отложений, а другая с высокой концентрацией отложений и почвы. Образцы, содержащие только воду и не содержащие осадка, инокулировали непосредственно в сокультурах. Образцы с осадком и почвой были предварительно обработаны путем добавления четырехкратного объема стерильного физиологического раствора амебы Пейджа (PAS), встряхивания и предоставления им возможности отстояться перед декантацией и последующей фильтрацией через бумажный фильтр для удаления крупных частиц осадка. Образцы хранили при 4°C до процедур инокуляции.

Процедуры культивирования

Носителями амеб для совместного культивирования были AC (штамм NEFF), AP (штамм LINC AP1), Acanthamoeba griffini (AG; штамм ATCC 50702) и VV (штамм CDC 19). Штаммы амеб содержали в культуральной колбе объемом 75 см 2 с 30 мл среды пептон-дрожжевой экстракт-глюкоза (PYG) при различных температурах в зависимости от видовой специфичности.Температуры составляли 28°C для AC и VV и 30°C для AP . После инокуляции АР и АС хранили при 32°С, а ВВ при 30°С соответственно. AG также хранили при 35°C до и после инокуляции. Через 24 ч роста клетки собирали и осаждали центрифугированием. Супернатант удаляли, а амебы дважды ресуспендировали в стерильном ПАСК. После последней стадии центрифугирования амеб снова суспендировали в 30 мл ПАСК с добавлением смеси антибиотиков, содержащей 10 мкл ципрофлоксацина (4 мкг/мл; Panpharma, Z. I., Clairay, Франция), 10 мкл ванкомицина (4 мкг/мл; Mylan, Saint-Priest, Франция), 10 мкл колимицина (500 МЕ/мл; Sanofi Aventis, Париж, Франция), 10 мкл рифампицина ( 4 мкг/мл; Sanofi Aventis) и 10 мкл фунгизона (100 мкг/мл; Bristol-Myers Squibb, Rueil-Malmaison, France). Затем суспензию распределяли по 0,5 мл в лунки 24-луночного планшета с концентрацией клеток в суспензии в диапазоне 1,10 6 – 5,10 5 /мл. Каждая проба объемом 100 мкл засевалась в лунки и инкубировалась с учетом температурной специфичности роста амеб во влажной камере.Эти совместные культуры инкубировали в течение 4 дней, а затем дважды субкультивировали на свежих амебах в разведении в одну десятую, как описано выше. Через 3 дня лунки наблюдали под оптической микроскопией на третьем пассаже, а лунки с лизисом амеб дополнительно анализировали как положительные на наличие гигантских вирусов. В каждом микропланшете использовали отрицательный амебный контроль без каких-либо инокулированных образцов.

Цитоспин и окрашивание

100 мкл объема культуры амеб с лизисом повторно инокулировали в 1 мл суспензии свежих амеб, дополненных смесью антибиотиков, в 12-луночные планшеты (1/10 разведения), затем инокулировали на те же кокультуры в соответствии с процедурами описано выше.Примерно через 16–18 ч амебы округлялись, поэтому 100 мкл ранее инокулированной суспензии обрабатывали в цитоспине и фиксировали метанолом. Вирусные фабрики и вирусные частицы наблюдались после окрашивания гемаколором или флуоресцентной маркировки (Hemacolor ® , Merck, Дармштадт, Германия; Boughalmi et al., 2013a,b,c; дополнительная фигура S1).

Экстракция ДНК и ПЦР-анализ

В сочетании с процедурами цитоспина 200 мкл каждой инокулированной суспензии использовали для выделения ДНК.Оставшийся объем образца замораживали при -80°С для дальнейшего использования. Вирусную ДНК выделяли с помощью автоматизированного набора EZ1 Virus Mini-Kit v.2 (Qiagen GmbH, Hilden, Germany) в соответствии с инструкциями производителя. Качество и концентрацию ДНК проверяли с помощью спектрофотометра с нанокаплями (Thermo Scientific, Уолтем, Массачусетс, США). ПЦР в реальном времени для идентификации линий марсельвирусов и мимивирусов на основе зондов гидролиза проводили, как описано Ngounga et al. (2013). Вкратце, тесты проводились с использованием набора для ПЦР QuantiTec Probe (Qiagen).Анализы ПЦР выполняли с использованием 5 мкл экстрагированной ДНК (~50 нанограммов) в реакционной смеси для амплификации, содержащей 12,5 мкл 2X QuantiTec Probe PCR Master Mix, 0,5 мкл зонда с концентрацией 1 пмоль/мкл и 0,5 мкл (0,2 мкМ) прямой и обратные праймеры для анализов мимивирусов линии В и марсельвирусов или 1 мкл (0,4 мкМ) прямых и обратных праймеров для анализов мимивирусов линий А и С. Анализы ПЦР доводили до конечного объема 25 мкл добавлением воды, не содержащей РНКазы/ДНКазы. ПЦР проводили на приборе системы реального времени CFX96TM (Bio-Rad, Hercules, CA, USA).Протокол ПЦР-амплификации был следующим: 15 мин при 95°С, затем 45 циклов денатурации при 95°С в течение 30 с и отжиг/удлинение при 60°С в течение 1 мин. Мимивирус известной линии A, B и C и марсельвирус использовали в качестве положительных контролей.

Учитывая высокое генетическое разнообразие мимивирусов и в случае отрицательных результатов ПЦР в реальном времени, стандартную ПЦР, предназначенную для снижения чувствительности к полиморфизму, проводили с использованием праймеров, нацеленных на ген мимивирусной полимеразы В (DNApol_R322 – прямой 5’AAACAGGTGCACCAACATCA и обратный 5 ‘GGTTTCCATTTTGACCCAAG).Анализы проводили с использованием набора ДНК-полимеразы HotStarTaq (Qiagen). Реакции ПЦР проводили с использованием 3 мкл выделенной ДНК (∼50 нанограммов) в реакционной смеси для амплификации, содержащей 0,25 мкл полимеразы Hot Start Taq (5 единиц/мкл), 2,5 мкл буфера 10X, 2,5 мкл MgCl 2 ( 25 мМ), 2,5 мкл dNTP и 1,0 мкл (10 мкМ) прямого и обратного праймеров для каждого анализа. Реакции доводили до конечного объема 25 мкл добавлением воды, не содержащей РНКазы/ДНКазы. Протокол ПЦР-амплификации был следующим: 15 мин при 95°С, затем 40 циклов денатурации при 95°С в течение 1 мин, отжиг при 56°С в течение 1 мин и удлинение при 72°С. Положительным контролем ДНК были штаммы мимивирусов линий A, B и C, регулярно поддерживаемые в лаборатории. Затем эти образцы очищали с использованием планшетов NucleoFast (Macherey-Nagel GmbH & Co. KG, Дюрен, Германия), а затем секвенировали с использованием праймеров для ПЦР, используемых в стандартном ПЦР-анализе, с использованием набора для секвенирования цикла ABI PRISM BigDye Terminator v3.1 (Applied Biosystems). , Фостер-Сити, Калифорния, США) в соответствии с инструкциями производителя. Последовательности собирали, анализировали с помощью программного обеспечения Chromaspro (Technelysium) и сравнивали с последовательностями в базе данных GenBank с использованием программного обеспечения BLAST

.

Вирусы, которые не были обнаружены ни с помощью ПЦР в реальном времени, ни с помощью стандартной ПЦР, были снова протестированы с окрашиванием Hemacolor для обнаружения оптических структур, идентичных другим вирусам, о которых сообщалось, как описано в разделе «Цитоспин и окрашивание».

Флуоресцентная маркировка

Помимо окрашивания гемаколором, используемого для предварительной морфологической характеристики, для визуализации вирусной фабрики использовали флуоресцентное мечение. Для этого 100 мл суспензии ранее инфицированных клеток в концентрации 4×10 5 клеток/мл распределяли в камеру Cytospin, центрифугировали 10 мин при 800 об/мин в Shandon Cytospin 4 (Thermo Electron Corporation), затем фиксируют в течение 10 мин в метаноле. Для прямой флуоресценции с окрашиванием DAPI (49,69-диамидино-2-фенилиндол) клетки покрывали 5 мМ DAPI из готового к использованию раствора «ProLong Gold Antifade Reagent» (Molecular Probes) и окрашивали в течение 10 мин в темнота перед наблюдением.Изображения были получены с помощью микроскопа LSM 510 Zeiss, при этом окрашивание DAPI наблюдали с использованием УФ-диода (405 нм), шаг z = 0,3 мм (Suzan-Monti et al., 2007; дополнительная фигура S2).

Электронная микроскопия

Вирусы, не идентифицированные с помощью ПЦР, также исследовали с помощью электронной микроскопии с использованием техники негативного окрашивания. В сетки после тлеющего разряда добавляли супернатант положительных образцов (20–40 мкл) на 10 мин для прилипания к сеткам. Образцы промывали, фиксировали и контрастировали 5% раствором молибдата аммония, повторно промывали и сушили перед электронно-микроскопическим анализом.Образцы наблюдались с помощью Morgagni 268 D (Philips), работающего при 100–60 кэВ, и Tecnai G2, работающего при 200 кэВ (дополнительный рисунок S3).

Образцы гигантского вируса из окружающей среды приведены в таблице 1, а результаты представлены на рисунке 2.

ТАБЛИЦА 1. Бразильский вирус, выделенный в образцах окружающей среды, представленных в зоне сбора, вирус, обнаруженный системой ПЦР, поддержкой амеб и положительными методами.

РИСУНОК 2. Диаграмма Венна, на которой показаны носители амеб и изолированные вирусы. В общей сложности 69 вирусов были выделены на трех различных платформах клеток AC Acanthamoeba polyphaga (AP) , Acanthamoeba griffinii (AG) . Вирусы происходят от одного и того же вида, и линии, обнаруженные с помощью ПЦР, представлены одним цветом. Пересечение круга показывает, что изоляты вирусов происходят из одних и тех же образцов окружающей среды на разных платформах выделения.Вся небольшая графика внутри круга представляет вид и родословную, обнаруженные с помощью ПЦР. Мимивирусы, которые не были обнаружены с помощью ПЦР, также представлены. Также указано количество и процент выделенных вирусов.

Полиморфизм

Трудности амплификации ДНК-полимеразы B могут быть связаны с высоким генетическим разнообразием вирусов, что приводит к низкой адгезии некоторых гигантских вирусных праймеров в регионах с высоким полиморфизмом. Оптимальное выравнивание предсказанных последовательностей ампликонов высококонсервативной ДНК-полимеразы B было проанализировано с использованием MEGA версии 6.0

Результаты

Выделение вирусов бразильского гиганта

Всего было выделено 69 вирусов в трех различных клеточных носителях ( n = 69; таблица 1). Самый высокий процент изоляции был в AP (46,38%), за которым следуют AC (39,13%) и AG (14,49%). В ВВ вирус не был выделен. Среди всех выделенных вирусов наиболее распространенным был мимивирус линии А (79,73%), за которым следовали мимивирусы линии С (4,35%) и мимивирусы линии В (1,45%). Необнаруженные линии мимивирусов представлены 10.15% изолятов. Также были выделены один марсельвирус (1,45%) и один пандоравирус (1,45%). В AG Mimivirus была выделена только линия A, в то время как AP позволил выделить все линии мимивирусов, а AC продемонстрировал возможную изоляцию различных видов гигантских вирусов Marseillevirus и Pandoravirus. (Таблица 1; Рисунок 2).

Из всех вирусов, происходящих из одного и того же образца окружающей среды, один мимивирус линии A был обнаружен в каждой из трех клеточных подложек Acanthamoeba (4.35%). Кроме того, AP и AC дали пять мимивирусов линии A из одного и того же образца окружающей среды (14,5%), в то время как AP и AG дали два мимивируса (5,8%), а AC и AG — два вируса (2,9%). (Таблица 1; Рисунок 2).

Вирусы, не обнаруженные с помощью системы ПЦР (10,15%), просматривали с помощью окрашивания гемаколором. Мимивирусоподобные структуры и вирусные фабрики внутри цитоплазмы были обнаружены при окрашивании предметных стекол (таблица 1; рисунок 2) (дополнительный рисунок S1). Некоторые вирусы также визуализировались с помощью флуоресцентной маркировки с использованием DAPI, и их можно было визуализировать на вирусной фабрике (дополнительная фигура S2).Отрицательное окрашивание также было выполнено для некоторых гигантских вирусов (дополнительная фигура S3).

При корреляции между тремя зонами сбора шесть гигантских вирусов (8,7%) были выделены в зоне 1, 31 (44,93%) — в зоне 2 и 32 (46,38%) — в зоне 3 (рис. 1; таблица 1). При сравнении клеточных носителей в AP были выделены три гигантских вируса (4,35%) из зоны 1, 14 гигантских вирусов из зоны 2 (20,29%) и 15 гигантских вирусов из зоны 3 (21,74%). Один гигантский вирус (1,45%) из Зоны 1, 11 гигантских вирусов из Зоны 2 (15. 94%) и 15 из Зоны 3 (21,74%) были выделены в АС. В АГ были выделены два гигантских вируса (2,9%) из зоны 1, шесть вирусов из зоны 2 (8,7%) и два вируса из зоны 3 (2,9%).

Полиморфизм

Оптимальное выравнивание предсказанных высококонсервативных последовательностей гена ДНК-полимеразы В показало несколько замен полиморфизма в полученных нами ампликонах мимивирусов по сравнению с другими доступными последовательностями (рис. 3). Последовательности были депонированы в GenBank под следующими инвентарными номерами: KT321945-KT321969.

РИСУНОК 3. Нуклеотидная последовательность фрагмента гена мимивирусной ДНК-полимеразы В. Образцы, полученные в этом исследовании, подчеркнуты; полужирный шрифт указывает на полиморфность.

Обсуждение

Используя инокуляцию панели простейших в качестве основы для совместного культивирования, мы смогли выделить 69 гигантских вирусов из образцов окружающей среды Бразилии. Со времени первого сообщения о выделении мимивируса (La Scola et al. , 2003) многие гигантские вирусы были обнаружены и выделены из различных сред и даже у людей (La Scola et al., 2003, 2008; Арслан и др., 2011; Саади и др., 2013a,b; Кампос и др., 2014 г.; Дорнас и др., 2014а; Шейд и др., 2014; Андраде и др., 2015; Ассис и др., 2015; Ретено и др., 2015). Выделение и обнаружение происходили с разной частотой в разных исследованных образцах, с низким уровнем положительных результатов обнаружения и выделения в бронхоальвеолярном лаваже и фекалиях (Saadi et al., 2013a,b) и более сильными положительными результатами в почве, воде и сточных водах (Pagnier et al. al., 2013; Campos et al., 2014; Dornas et al., 2014a,b; Assis et al., 2015; Ретено и др., 2015). Выбранные здесь образцы окружающей среды ранее были описаны как источники для выделения многочисленных гигантских вирусов (Gaze et al., 2011; Pagnier et al., 2013; Philippe et al., 2013; Assis et al., 2015; Reteno et al., 2015) и представляют собой хороший набор образцов для сравнения различных амеб по их способности выделять гигантские вирусы.

Из-за препятствий и задержки выделения гигантского вируса традиционный метод выделения был изменен. Концентрация образца путем фильтрации была впервые описана La Scola et al.(2008). Впоследствии этот метод был дополнен антибиотиками в совместном культивировании для уменьшения избыточного бактериального роста (La Scola et al., 2010). Однако высокая концентрация антибиотиков могла повлиять на рост амебы и, следовательно, уменьшить количество выделенных новых гигантских вирусов. Процедура была предварительно улучшена с помощью предварительного обогащения, состоящего из инкубации образца в темной камере с органическими источниками, что позволило размножить гетеротрофные бактерии, а затем инокулировать монослой амеб (Arslan et al., 2011). Метод выделения был изменен путем добавления свободной амебы AC в среду наполовину вода/наполовину рис в течение примерно 30 дней (Dornas et al., 2014b).

С помощью этого модифицированного метода удалось выделить некоторые гигантские вирусы линии А в бразильских экосистемах (Campos et al. , 2014; Andrade et al., 2015; Assis et al., 2015). Хотя этот метод позволяет изолировать мимивирусы линии А, предыдущий метод продемонстрировал низкий уровень положительных результатов (1,2%), что позволяет предположить, что прямая инокуляция, выбранная для этого проекта, более чувствительна, чем методы, о которых сообщалось ранее (Arslan et al., 2011; Дорнас и др., 2014b).

В этом ключе, стремясь улучшить изоляцию гигантских вирусов, высокопроизводительный метод, ранее разработанный для выделения фикоднавирусов (Fitzgerald et al., 2010) в клетках водорослей, был стандартизирован для выделения в зависимости от вида Acanthamoeba гигантский вирус sp. С помощью этого метода было протестировано более 1000 образцов, в результате чего было выделено несколько гигантских вирусов, что показало, что этот метод можно быстро использовать для больших коллекций образцов из окружающей среды (Boughalmi et al., 2013а).

Благодаря этим возросшим возможностям изоляции в группе беспозвоночных начали исследовать новые образцы, такие как личинки вида Hirudo medicalis (Boughalmi et al. , 2013b) и пиявки вида Eristalis tenax (Boughalmi et al., 2013с). Виды сначала дезинфицировали спиртом (Slimani et al., 2013), затем части органов мацерировали отдельно, а затем инокулировали в кокультуре амеб на чашках с агаром (Boughalmi et al., 2013а).

Хотя все методы выделения представляются как эволюция методов выделения, тем не менее остается большое расхождение между частотой обнаружения молекулярными методами и фактической частотой выделения (Ghedin and Claverie, 2005; Kristensen et al., 2010). . Одним из возможных объяснений этого является большое разнообразие потенциально существующих гигантских вирусов, которым теоретически требуется широкий спектр амебных клеток в качестве основы для совместного культивирования.

Как уже упоминалось, из-за низкого уровня положительных результатов для метода выделения методы молекулярной биологии для обнаружения гигантских вирусов развивались независимо.Что касается количества изолятов, геномы которых были секвенированы, то единственное увеличение, о котором сообщалось, было в генерических праймерах для линии мимивирусов или других видов, таких как Marseillevirus sp. , Pandoravirus sp. и Faustovirus sp. (La Scola et al., 2010; Boughalmi et al., 2013a; Ngounga et al., 2013; Pagnier et al., 2013; Philippe et al., 2013). Однако высокое генетическое разнообразие может объяснить трудности в амплификации некоторых сохранившихся специфичных для линии участков, что описывается генетическим полиморфизмом (Dornas et al., 2014а; Андраде и др., 2015; Сантос Силва и др., 2015). Примечательно, что в этой работе тщательно проанализирована причина ПЦР-негативных гигантских вирусов, обнаруженных ранее путем лизиса амеб и наблюдаемых с помощью оптической микроскопии в пятнах.

Хотя сообщалось об выделении гигантских вирусов с использованием AC или VV в качестве клеточной подложки, большинство из них было выделено с использованием AP, что также представлено в этой работе (La Scola et al., 2008, 2010; Arslan et al., 2011; Boughalmi et al. ., 2013a; Pagnier et al., 2013; Saadi et al., 2013а; Шейд и др., 2014; Ретено и др., 2015). Однако уже было продемонстрировано, что амеба AC эффективна при выделении гигантских вирусов, особенно при выделении более разнообразных семейств вирусов, таких как Pandoravirus и Pithovirus, тогда как AP, по-видимому, более специфичен для мимивирусов. В настоящем исследовании АГ впервые использовали в качестве амебной подложки для выделения гигантских вирусов. По-видимому, он обладает меньшей чувствительностью к изоляции и специфичностью, чем другие носители клеток, хотя все еще невозможно сделать вывод, связано ли это с этой конкретной амебой или с температурой инкубации, используемой для этого вида, которая могла иметь ограниченную первичную изоляцию гигантских вирусов.

Несмотря на то, что из всех вирусов, выделенных из бразильских образцов, наблюдается высокая частота мимивирусов линии А (Campos et al., 2014; Andrade et al., 2015; Assis et al., 2015), как сообщается в этом исследовании, другие Сообщалось также о мимивирусах линии B или C, а также о марсельвирусе и пандоравирусе. Удивительно, но при сравнении различных видов амеб по клеточной поддержке из одного и того же образца окружающей среды было выделено несколько гигантских вирусов (таблица 1). Это предполагает тропизм, предполагающий тесную связь между вирусом и хозяином. Возможными объяснениями могут быть генетическое разнообразие, такое как гены, участвующие в трансляции РНК, процесс трансляции генов, а также факторы, участвующие в размножении вирусов. Более того, этот тропизм может свидетельствовать о том, что гигантские вирусы эволюционировали вместе со своим хозяином.

Высокий уровень положительных результатов в Зоне 2 после химической обработки воды, а также в Зоне 3, изолированной точке лагуны, предполагает, что одной только химической обработки может быть недостаточно для элиминации мимивируса из воды. Биоциды не полностью эффективны для элиминации мимивируса, различаясь по времени обработки и составу (Campos et al., 2012). Также вирус можно устранить химической обработкой и контактом с окружающей почвой; вирус лучше размножается в очистных сооружениях, чем в сточных водах, где у нас более широкая конкуренция со многими бактериями и другими вирусами. Низкий положительный результат в образце сточных вод предполагает, что вирус может размножаться не лучше, чем в воде или даже в почве, что позволяет предположить, что высокая концентрация микроорганизмов создает конкуренцию, и эта конкуренция может мешать размножению. Марсельвирус был выделен выше по течению от химической очистки сточных вод, а пандоравирус — из изолированного участка лагуны.Для редких гигантских вирусов, выделенных из сточных вод, будет трудно сопоставить их с изолятами, полученными при очистке сточных вод. Другими словами, тот факт, что мы выделили только один марсельвирус из сточных вод, не может позволить нам установить связь между химически обработанными сточными водами и удаленными сточными водами, потому что разнообразие имеет большое значение для корреляции между средами. В этой работе мы можем выдвинуть гипотезу, чтобы попытаться понять, как эти вирусы циркулируют в природе. Благодаря этим результатам мы можем предположить, что некоторые виды гигантских вирусов могут проявлять специфичность к хозяину Acanthamoeba .Кроме того, с бразильскими образцами окружающей среды мы подтвердили высокую частоту мимивирусов линии А, а также различия в сродстве вирусов к разным амебам, используемым в качестве платформ для процедуры выделения.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить наших коллег из GEPVIG и Лаборатории вирусов Федерального университета Минас-Жерайс, а также CNPq, CAPES, FAPEMIG и Pro-Reitoria de Pesquisa da Universidade Federal de Minas Gerais (PRPq-UFMG) за финансовую поддержку.Эта работа частично финансировалась фондом IHU Méditerranée Infection.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fmicb.2015.01086

.

РИСУНОК S1 | Изображения, полученные при окрашивании гемоколором некоторых выделенных вирусов. Cytospin, фиксацию и окрашивание проводили через 18 ч после инфицирования. Звездочки на изображении показывают вирусную фабрику, а стрелки на рисунке 2. (G) показывают частицу вируса Пандоры. Оригинальное увеличение ×1000. (A) Отрицательный контроль Acanthamoeba castellanii ; (B) AC BZ 01 Марсельвирус; (C) AC BZ 16 Мимивирус; (D) AC BZ 24 Мимивирус; (E) AP BZ 04 Мимивирус; (F) AP BZ 87 Мимивирус; (G) AC BZ 81 Пандоравирус.

РИСУНОК S2 | Изображения, полученные при мечении флуоресценцией DAPI некоторых вирусов, выделенных и инокулированных в одну и ту же изолированную клеточную систему. Cytospin, фиксацию и флуоресценцию мечения проводили через 18 часов после инфицирования. Вирусная фабрика была показана на изображениях. Оригинальное увеличение ×1000. (A) Отрицательный контроль A. polyphaga ; (Б) АП БЗ 88; (С) АП БЗ 87; (Д) АП БЗ 71.

РИСУНОК S3 | Отрицательное окрашивание изолята вирусов бразильского гиганта. супернатантов образца использовали через 18 ч после инфицирования. (A) AC BZ 01 Марсельвирус; (B) AC BZ 28 Мимивирус; (C) Частицы вирофага обнаружены в AC BZ 28; (D) AP BZ 16 Мимивирус; (E) AC BZ 81 Пандоравирус; (F) AP BZ 87 Мимивирус.

Сноски

  1. http://blast.ncbi.nlm.nih.gov/
  2. www.megasoftware.net

Каталожные номера

Andrade, K.R., Boratto, P.V.M., Rodrigues, F.P., Silva, L.C.F., Dornas, F.P., Pilotto, M.R., et al. (2015). Устрицы как горячие точки для выделения мимивирусов. Арх. Вирол. 160, 477–482. doi: 10.1007/s00705-014-2257-2

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Арслан, Д., Лежандр М., Зельцер В., Абергель К. и Клавери Дж. М. (2011). Отдаленный родственник мимивируса с более крупным геномом подчеркивает основные черты Megaviridae. Проц. Натл. акад. науч. США 108, 17486–17491. doi: 10.1073/pnas.1110889108

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ассис Ф., Байраи Л., Абрахао Дж., Крун Э.Г., Дорнас Ф.П., Андраде К.Р. и соавт. (2015). Пангеномный анализ амебных мимивирусов бразильской линии А. Вирусы 7, 3483–3499. дои: 10.3390/v7072782

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бугалми, М., Саади, Х., Панье, И., Колсон, П., Фурнус, Г., Рауль, Д., и соавт. (2013а). Высокопроизводительная изоляция гигантских вирусов семейств Mimiviridae и Marseilleviridae в среде Туниса. Окружающая среда. микробиол. 15, 2000–2007 гг. дои: 10.1111/1462-2920.12068

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бугалми, М., Панье И., Аэрфи С., Колсон П., Рауль Д. и Ла Скола Б. (2013b). Первое выделение гигантского вируса из дикого Hirudo medicalis Пиявка: выделение Mimiviridae в Hirudo medicalis . Вирусы 5, 2920–2930. дои: 10.3390/v5122920

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бугалми М., Панье И., Аэрфи С., Колсон П., Рауль Д. и Ла Скола Б. (2013c). Первое выделение марсельвируса у двукрылых syrphidae Eristalis tenax . Интервирусология 56, 386–394. дои: 10.1159/000354560

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Boyer, M., Yutin, N., Pagnier, I., Barrassi, L., Fournous, G., Espinosa, L., et al. (2009). Гигантский марсельвирус подчеркивает роль амеб как плавильного котла в появлении химерных микроорганизмов. Проц. Натл. акад. науч. США 106, 21848–21853. doi: 10.1073/pnas.0

4106

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кампос, Р.К., Андраде, К.Р., Феррейра, П.С., Бонжардим, С.А., Ла Скола, Б., Крун, Э.Г., и соавт. (2012). Вирулицидная активность химических биоцидов в отношении мимивируса, предполагаемого возбудителя пневмонии. Дж. Клин. Вирол. 55, 323–328. doi: 10.1016/j.jcv.2012.08.009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кампос, Р.К., Боратто, П.В., Ассис, Ф.Л., Агиар, Э.Р., Сильва, Л.К., Альбарназ, Дж.Д., и соавт. (2014). Вирус Самба: новый мимивирус из гигантского тропического леса бразильской Амазонки. Вирол. J. 11, 95. doi: 10.1186/1743-422X-11-95

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Колсон, П., Ламбаллери, X., Фурнус, Г., и Рауль, Д. (2012). Переклассификация гигантских вирусов, составляющих четвертый домен жизни в мегавирусах нового порядка. Интервирусология 55, 321–332. дои: 10.1159/000336562

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Колсон, П., Панье, И., Юсуф, Н., Фурнус, Г., Ла Скола, Б., и Рауль, Д. (2013). «Marseilleviridae», новое семейство гигантских вирусов, поражающих амеб. Арх. Вирол. 158, 915–920. doi: 10.1007/s00705-012-1537-y

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Дорнас, Ф. П., Родригес, Ф. П., Боратто, П. В., Сильва, Л. К., Феррейра, П. К., Бонжардим, К. А., и соавт. (2014а). Циркуляция мимивирусов среди диких и домашних млекопитающих, регион Амазонки, Бразилия. Экстренный. Заразить. Дис. 20, 469–472.doi: 10.3201/eid2003.131050

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Дорнас, Ф.П., Сильва, Л.К., де Алмейда, Г.М., Кампос, Р.К., Боратто, П.В., Франко-Луис, А.П., и соавт. (2014б). Стабильность мимивируса Acanthamoeba polyphaga в окружающей среде и клинических субстратах: последствия для обнаружения и выделения вируса. PLoS ONE 9:e87811. doi: 10.1371/journal.pone.0087811

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фицджеральд, Л.А., Ву, П.К., Гернон, Дж.Р., Биффингер, Дж.К., Рингейзен, Б.Р., и Ван Эттен, Дж.Л. (2010). Выделение фикоднавируса PBCV-1 методом биологической лазерной печати. Дж. Вирол. Методы 167, 223–225. doi: 10.1016/j.jviromet.2010.04.005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Gaze, WH, Morgan, G., Zhang, L., and Wellington, EM (2011). Мимивирусоподобные частицы в акантамебе из осадка сточных вод. Экстренный. Заразить. Дис. 17, 1127–1129.дои: 10.3201/eid1706.101282

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кристенсен Д.М., Мушегян А.Р., Доля В.В. и Кунин Е.В. (2010). Новые измерения вирусного мира, открытые с помощью метагеномики. Тенденции микробиол. 18, 11–19. doi: 10.1016/j.tim.2009.11.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ла Скола, Б., Одик, С., Роберт, К., Юнганг, Л., де Ламбальри, X., Дранкур, М. и другие.(2003). Гигантский вирус у амеб. Наука 299, 2033. doi: 10.1126/science.1081867

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ла Скола, Б., Кампокассо, А., Н’Донг, Р., Фурнус, Г., Баррасси, Л., Флодропс, К., и др. (2010). Предварительная характеристика новых экологических гигантских вирусов с помощью масс-спектрометрии MALDI-TOF. Интервирусология 53, 344–353. дои: 10.1159/000312919

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ла Скола, Б. , Desnues, C., Pagnier, I., Robert, C., Barrassi, L., Fournous, G., et al. (2008). Вирофаг как уникальный паразит гигантского мимивируса. Природа 455, 100–104. doi: 10.1038/nature07218

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нгунга, Т., Панье, И., Ретено, Д.Г., Рауль, Д., Ла Скола, Б., и Колсон, П. (2013). Системы ПЦР в реальном времени, нацеленные на гигантские вирусы амеб и их вирофаги. Интервирусология 56, 413–423. дои: 10.1159/000354563

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Pagnier, I., Reteno, D.G.I., Saadi, H., Boughalmi, M., Gaia, M., Slimani, M., et al. (2013). Десятилетие улучшений в выделении мимивирусов и марселевирусов из амебы. Интервирусология 56, 354–363. дои: 10.1159/000354556

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Филипп, Н., Лежандр, М., Дутр, Г., Куте, Ю., Пуаро, О., Леско, М., и др.(2013). Пандоравирусы: вирусы амебы с геномом до 2,5 Мб, достигающим генома паразитических эукариот. Наука 341, 281. doi: 10.1126/science.1239181

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рауль Д., Аудик С., Роберт С., Абергель С., Ренесто П., Огата Х. и др. (2004). Последовательность генома мимивируса размером 1,2 мегабаза. Наука 306, 1344–1350. doi: 10.1126/science.1101485

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ретено, Д.Г., Бенамар С., Халил Дж. Б., Андреани Дж., Армстронг Н., Клозе Т. и др. (2015). Фаустовирус, связанная с асфарвирусом новая линия гигантских вирусов, заражающих амеб. Дж. Вирол. 89, 6585–6594. doi: 10.1128/ОВИ.00115-15

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Саади, Х., Панье, И., Колсон, П., Шериф, Дж. К., Беджи, М., Бугалми, М., и соавт. (2013а). Первое выделение мимивируса у больного пневмонией. клин. Заразить. Дис. 57:e127–e134.doi: 10.1093/cid/cit354

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Саади, Х. , Ретено, Д.Г., Колсон, П., Ахерфи, С., Минодье, П., Панье, И., и соавт. (2013б). Вирус Шан: новый мимивирус, выделенный из стула тунисского пациента с пневмонией. Интервирусология 56, 424–429. дои: 10.1159/000354564

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сантос Силва, Л.К., Арантес, Т.С., Андраде, К.Р., Родригес, Р.A.L., Boratto, P.V.M., Almeida, G.M.F., et al. (2015). Высокая позитивность мимивируса на неодушевленных поверхностях больничного изолятора органов дыхания, Бразилия. Дж. Клин. Вирол. 66, 62–65. doi: 10.1016/j.jcv.2015.03.008

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шейд, П., Балчун, К., и Шауб, Г. А. (2014). Раскрываются некоторые секреты: паразитарные кератитные амебы как переносчики мало описанных пандоравирусов к человеку. Паразитол.Рез. 113, 3759–3764. doi: 10.1007/s00436-014-4041-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Слимани, М. , Панье, И., Бугалми, М., Рауль, Д., и Ла Скола, Б. (2013). Процедура спиртовой дезинфекции для выделения гигантских вирусов из зараженных образцов. Интервирусология 56, 434–440. дои: 10.1159/000354566

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сюзан-Монти, М., Ла Скола, Б., Барраси, Л., Эспиноса, Л.и Рауль, Д. (2007). Ультраструктурная характеристика гигантской вулканоподобной вирусной фабрики Acanthamoeba polyphaga Mimivirus. PLoS ONE 2:e328. doi: 10.1371/journal.pone.0000328

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

.

Добавить комментарий

Ваш адрес email не будет опубликован.

2015-2019 © Игровая комната «Волшебный лес», Челябинск
тел.:+7 351 724-05-51, +7 351 777-22-55 игровая комната челябинск, праздник детям челябинск

Прогресс 01.05.01 по 30.04.05 Были исследованы два протокола промывки. Буфер для элюирования (0,1 М трис, рН 7,4, 1 мМ ЭДТА, 0,01% лаурет 12 и пеногаситель А) оказался более эффективным при удалении паразитов из экспериментально добавленных продуктов, чем промывание продуктов водой. Идентификация паразитов более эффективно определялась с помощью ПЦР, чем с помощью обычной микроскопии.Это особенно верно в отношении Cryptosporidium, поскольку в свежих продуктах присутствуют различные виды. Традиционное наблюдение овощных смывов с помощью флуоресцентной или фазово-контрастной микроскопии занимает много времени и требует наличия опытного микроскописта. Экстракция ДНК паразитов очень эффективна с использованием набора для быстрой экстракции ДНК, а обнаружение положительных результатов происходит быстрее и точнее, особенно в случае Cryptosporidium. Этот набор также снижает количество ложноположительных результатов на Cyclospora.Использование молекулярных инструментов является предпочтительным, поскольку количество паразитов, присутствующих в продуктах, невелико и не может быть обогащено бактериальными загрязнителями. ОТ-ПЦР была успешно разработана для определения жизнеспособности Cryptosporidium. RT-PCR с использованием мРНК b-тубулина использовали в качестве индикатора жизнеспособности ооцист Cryptosporidium parvum. Обычные методы оценки жизнеспособности Cyclospora cayetanensis, такие как витальные окрашивания и клеточные культуры, пока недоступны. Хотя ооцисты Cyclospora были зарегистрированы у животных (утка, куры, собаки и нечеловекообразные приматы), попытки установить экспериментальную инфекцию с целью разработки модели на животных не увенчались успехом. Споруляция ооцист обеспечивает средство для определения жизнеспособности, но для этого требуется 2 или более недель, а споруляция обычно достигается с 40-80% ооцист, поэтому существует потребность в быстрых и чувствительных анализах жизнеспособности, которые будут работать на уровне одного организма. . Частичные последовательности гена b-тубулина Cyclospora были секвенированы, чтобы использовать их для ОТ-ПЦР. Эта ОТ-ПЦР метод обеспечит дополнительное обнаружение и анализ жизнеспособности для использования в пробах окружающей среды.

Воздействия
Были усовершенствованы методологии выделения паразита из свежих продуктов, и был разработан альтернативный тест на жизнеспособность Cyclospora, помогающий в определении инфекционности изолятов пищевого происхождения.

Публикации

  • Никаких публикаций Зарегистрировано этот период

Прогресс

Прогресс 01/01/04 по 12/31/04

Выходы
Методология, которая лучше всего работала для паразита. при выделении из свежих продуктов использовали промывочный буфер для элюции (0,1 М Трис, рН 7,4, 1 мМ ЭДТА, 0,01% Лаурет 12 и Antifoam A) вместо дистиллированной воды. Эффективность идентификации паразитов выше при использовании ПЦР по сравнению с обычной микроскопией.Традиционное наблюдение овощных смывов с помощью флуоресцентной или фазово-контрастной микроскопии занимает много времени и требует наличия опытного микроскописта. Экстракция ДНК паразитов очень эффективна с использованием комплекта для быстрой экстракции ДНК, а обнаружение положительных продуктов происходит быстрее и точнее, особенно в случае Cryptosporidium, и снижает количество ложноположительных результатов для Cyclospora. Поскольку количество паразитов, присутствующих в продуктах, невелико и не может быть обогащено, как это произошло бы с бактериальными загрязнителями, предпочтение отдается использованию молекулярных инструментов.Кроме того, Cryptosporidium можно захватить с помощью анализа на основе антител (выход 60-84%), а затем метят с помощью прямого флуоресцентного анализа. Однако жизнеспособность изолированных ооцист недоступна, если в протокол не включено использование витальных красителей, культивирования in vitro или животных моделей. Тем не менее, эти методы требуют большого количества ооцист, которые обычно не извлекаются из продуктов.

Воздействие
Результаты этого проекта будут способствовать разработке методологий обнаружения и идентификации, которые можно будет использовать для наблюдения и изучения вспышек паразитов, связанных со свежей зеленью.

Публикации


    • Никаких публикаций Зарегистрировано этот период

Прогресс 01/01/03 до 12/31/03

Выходы
Parasity Protozoa были определены в разных продуктах питания матрицы и в различных регионах мира. Последствия их для общественного здравоохранения признаются. Методологии их изоляции и точной идентификации могут быть хорошо использованы при расследовании вспышек, а также в исследованиях по эпиднадзору. Свежие продукты, экспериментально зараженные цистами и ооцистами, были обработаны с использованием воды или буфера для элюирования, второй из которых более эффективен для восстановления паразитов. Необходимо учитывать пищевую матрицу. При сравнении базилика, салата и малины наименьшее извлечение было достигнуто при использовании малины. Исследование лямблий и криптоспоридий методом иммунофлуоресценции требует много времени и не обладает специфичностью для идентификации видов паразитов. Восстановление ДНК из пищевых продуктов оценивали с использованием хелатирующих агентов, замораживания-оттаивания и набора для выделения FastaDNA.БСА и молоко были включены в анализ ПЦР для изучения влияния ингибиторов на усиление желаемого продукта. Набор FastaDNA оказался чувствительным, а молоко или БСА эффективно блокировали ингибиторы.

Воздействие
Результаты этого проекта будут способствовать разработке методологий обнаружения и идентификации, которые можно будет использовать для наблюдения и изучения вспышек паразитов, связанных со свежей зеленью.

Публикации


    • Никаких публикаций Зарегистрировано этот период

Прогресс

Прогресс 01/01/02 по 12/31/02

Выходы
различные методологии на ооцист. были оценены.Зеленолистный салат инокулировали точечно 100 и 10 ооцистами. Листья салата помещали в мешки для живота и инкубировали в течение 1 часа при 23°C, чтобы способствовать прикреплению ооцист к поверхности листьев. Ооцисты Cyclospora наблюдали с помощью эпифлуоресцентного микроскопа. Выход ооцист Cyclospora составлял от 4 до 10% от исходного инокулята. Ооцисты Cryptosporidium удаляли из овощей, как описано ранее, и окрашивали меченым FITC антителом (Meridian Diagnostics Inc.). Затем ооцисты наблюдали с помощью эпифлуоресцентного микроскопа.Выход Cryptosporidium находился в пределах 35-35,5% от исходного инокулята. Была оценена вторая стратегия. Используя ту же основную процедуру, что и в предыдущем эксперименте, вместо дистиллированной воды использовали промывочный буфер для элюции (0,1 М Трис, рН 7,4, 1 мМ ЭДТА, 0,01% Лаурет 12 и Antifoam A). В случае с Cryptosporidium вместо непосредственно мечя ооцисты, их концентрировали из растительных смывов с помощью иммуномагнитной сепарации (Dynal) с последующим мечением ИФА. Извлечение Cryptosporidium составило 60-84% от инокулята из 100 ооцист.Cyclospora оценивали по той же методике. Показатели восстановления увеличились до 30-56%. Когда в этом эксперименте использовали базилик, выход Cyclospora составил 14-21%.

Воздействие
Предварительные результаты показывают, что удаление паразитов можно улучшить с помощью буферного раствора, содержащего детергент. Эта информация является ценной при подготовке средств контроля, которые будут использоваться в исследованиях свежей продукции на наличие паразитов и эффективности восстановления.

Публикации



    • Никаких публикаций Зарегистрировано этот период

Прогресс 01/01/01 по 12/31/01

Выходы
Этот грант был инициирован в апреле 2001 года. Были сопоставлены различные методы очистки для улучшения извлечения простейших паразитов (Cryptosporidium и Cyclospora) из пищевых матриц. Воду и трис-буфер с детергентом и без него сравнивали для определения эффективности извлечения. При промывках дистиллированной водой выход ооцист составлял 15-30%, тогда как при промывках трис-буфером, содержащим детергент, выход ооцист из различных видов продукции был лучше (40-70%). Эффективность восстановления зависела от времени между инокуляцией и подготовкой образца.До 90% ооцист извлекалось, когда обработка начиналась сразу после помещения паразитов в продукцию. Это восстановление было снижено после 1 часа инкубации перед обработкой образцов (40-70%). Листья салата (25 г) помещали в мешочки для кормления и замачивали в течение 30 минут в шейкере. Смывы салата помещали в пробирки и центрифугировали при 1500 g в течение 20 минут. Пеллеты были наблюдали (с использованием возбуждающего фильтра 365 DM) под УФ-эпифлуоресцентной микроскопией для определения присутствия Cyclospora. Ооцисты Cryptosporidium дополнительно извлекали с помощью иммуномагнитного разделения Dynabeadsr anti-Cryptosporidium (Dynal Biotech, Inc. Lake Success, NY) с последующей идентификацией с использованием прямого флуоресцентного анализа, Merifluor DFA (Meridian Diagnostics, Inc., Цинциннати, Огайо).

Воздействие
Предварительные результаты показывают, что удаление паразитов можно улучшить с помощью буферного раствора, содержащего детергент. Эта информация является ценной при подготовке средств контроля, которые будут использоваться в исследованиях свежей продукции на наличие паразитов и эффективности восстановления.

Публикации


    • Нет публикаций Об этом периоде